Hemoglobinopathy

A Hungarian-American kindred with familial primary pulmonary hypertension (PPH) and a new, low-oxygen affinity [beta]-chain variant hemoglobin, Hb Washtenaw, is described. The index case presented with severe PPH and was found to have the abnormal hemoglobin. Two siblings with the abnormal hemoglobin also demonstrated increased pulmonary artery pressures on exercise echocardiography suggestive of early PPH. The occurrence of PPH and the abnormal hemoglobin could be due to genetic or biochemical factors or simply coincidental. A previous study had described a possible association of an abnormal [beta]-chain variant hemoglobin, Hb Warsaw, and PPH. It was suggested that the putative gene for familial PPH may be located near the [beta]-globin gene on chromosome 11. The association of PPH and the [beta]-chain variant hemoglobin in this kindred adds further support to this hypothesis.

Familial primary pulmonary hypertension (PPH) is a rare autosomal dominant disease characterized by raised pulmonary pressures due to obliteration of the muscular pulmonary arteries and arterioles. The disease is associated with significant morbidity and mortality.(1) There are no clinical or pathologic differences between the idiopathic and familial types of PPH.(2) The molecular genetic basis of familial PPH is unknown. Recently, we described a new low-oxygen affinity [beta]-chain variant hemoglobin, Hb Washtenaw ([beta]11(A8)val[right arrow]phe) in a Hungarian-American family when the index case presented with severe, resting pulmonary hypertension associated with mild cyanosis.(3),(4) This report describes the clinical and echocardiographic findings of this kindred with a [beta]-chain variant hemoglobinopathy and evidence for familial PPH.

CASE REPORT

A 48-year-old white woman presented with progressive breathlessness over a period of 3 months. Physical examination demonstrated a prominent jugular venous a wave, increased pulmonic component [(P.sub.2]) of the second heart sound, a right-sided [S.sub.4] gallop, right ventricular heave, and peripheral cyanosis. Routine biochemical tests and CBC counts were normal. Chest radiography and surface echocardiography revealed enlarged pulmonary arteries and right ventricular enlargement. Pulmonary function and ventilationperfusion studies were normal. Transesophageal echocardiography confirmed right ventricular and right atrial enlargement with moderate tricuspid regurgitation and an estimated right ventricular systolic pressure of 82 mm Hg. Right heart catheterization confirmed the presence of pulmonary hypertension with a right ventricular pressure of 79/19 mm Hg, a pulmonary artery pressure of 80/36 mm Hg, and a pulmonary wedge pressure of 7 mm Hg. Arterial blood gas analysis showed a pH value of 7.42, a [Pco.sub.2] of 29 mm Hg, and a [PaO.sub.2] of 81 mm Hg (with the patient breathing room air). Arterial oxygen saturation values were repeatedly measured at 85%. Further, hematologic studies led to the identification of a new, low-oxygen affinity hemoglobin, Hb Washtenaw.(3),(4) The use of supplemental oxygen and calcium-channel blockers lowered the patient's pulmonary vascular resistance minimally; she is currently awaiting single-lung transplantation.

METHODS

Family Studies

The hemoglobin of the index case and nine additional family members was characterized using high-performance liquid chromatography as previously reported.(4) DNA also was prepared from peripheral blood leukocytes according to standard methods. The polymerase chain reaction was performed according to manufacturer's instructions (Perkin Elmer Cetus, Norwalk, Conn) to amplify a 1,623-base pair of DNA, including three exons and two intervening sequences (IVS) of the [beta]-globin gene. The primers A and B contained engineered restriction sites (underlined) in the 5' position (A=5'CACAGGTACCCAGGGCAGAGCCATCTATTG3' and B=5'CACACTGCAGCAGAATCCAGATGCTCAAGG3'). The products were digested with the restriction enzyme Mae III and separated on a 4% agarose gel. By this analysis, 5 of 7 family members were shown to have the G-T mutation at position 34 associated with Hb Washtenaw (Fig 1). In addition, a Mae III polymorphism in IVS-2 was detected in the same 5 family members with the Hb Washtenaw mutation.(5)

Echocardiography

Echocardiographic estimation of rest and exercise right ventricular systolic pressure was performed as previously described.(6) Exercise was performed on an upright bicycle in 2-min stages beginning with a workload of 25 W and increasing in 25-W increments. Echocardiographic imaging was performed using an Acuson 128XP/10 (Acuson; Mountain View, Calif). Imaging was performed at baseline, at the completion of each 2-min stage, immediately postexercise, and in recovery. Intravenous injections of agitated saline solution were used to intensify the spectral Doppler signal of tricuspid regurgitation. Right ventricular systolic pressure was calculated as the estimated right atrial pressure plus four times the square of the peak velocity of tricuspid regurgitation.(7) Right atrial pressure was estimated to be 5 mm Hg when the right atrium was normal in size and 14 mm Hg when the right atrium was enlarged.

Echocardiograms were performed on the two siblings and the son of the index case. All family members other than the index case were asymptomatic. The pedigree chart and the cardiac pressures are shown in Figure 2. During exercise, an inappropriate increase of right heart pressures that are normal at rest has been previously related to early stages of pulmonary hypertension.(6) Exercise-induced increases in right ventricular systolic pressure were demonstrated in two siblings of the index case, suggestive of early pulmonary hypertension. The son of the index case had normal right ventricular pressures during exercise echocardiography. Other family members with the abnormal hemoglobin declined cardiac testing.

[ILLUSTRATION OMITTED]

DISCUSSION

This is the second report of a family with an abnormal hemoglobin associated with PPH. Seven of nine members in this kindred have the abnormal hemoglobin and three siblings have evidence of pulmonary vascular disease. All three subjects with the abnormal echocardiograms carry the abnormal hemoglobin, raising the possibility of an association between these two diseases. The failure to identify elevated pulmonary pressures in the son of the presenting case does not exclude a linkage between the two diseases because the age of onset of PPH is variable. Recently, expanding trinucleotides have been shown to be the basis of some inherited genetic diseases where a gene is altered from one generation to another. This phenomenon, called `genetic anticipation,' may explain the increasing severity and declining age of onset of several inherited genetic disorders.(8) Loyd et al(9) have suggested that this mechanism may play a role in familial PPH when they recently studied several large kindreds with familial PPH.

[ILLUSTRATION OMITTED]

There is limited information on familial PPH from previous studies. Abnormalities in fibrinopeptide A levels before development of pulmonary hypertension have been reported.(10) It has been suggested that a defect in the endothelium of the pulmonary vascular bed leads to the pathologic changes of plexogenic and/or thrombotic arteriopathy and pulmonary hypertension. Morse et al(11) described four families with PPH and studied their HLA antigens, immunoglobulin isotypes, and autoantibody status. They did not identify any haplotype that could be directly linked to the transmission of PPH. However, there appeared to be an association with DR3, DRw52, and DQw3. A relationship between the susceptibility to PPH and genes located near or within the HLA region on chromosome 6 was suggested. The fawn hooded rat has an inherited predisposition to develop pulmonary hypertension which can be blocked by raising the rats in a mildly enriched oxygen environment.(12) The genetic basis for PPH in this animal model is unknown. Pulmonary abnormalities have been described in other [beta]-globin disorders.(13) (14) The pulmonary hypertension in sickle cell disease is secondary to endothelial damage caused by the sickled RBCs.(13) The original cases of Hb Malmo, a high-oxygen affinity hemoglobin, had pulmonary fibrosis and thrombi throughout their pulmonary vasculature, but other Hb Malmo kindreds have failed to show pulmonary hypertension (personal communication, V.F. Fairbanks, MD, May 1994).(14) Severe neonatal pulmonary hypertension has been observed in two siblings with [gamma][delta][beta]-thalassemia trait. A patient with unstable Hb Olmsted died at age 36 years with pulmonary insufficiency, but other members of his extensive family were normal (personal communication, V.F. Fairbanks, MD, May 1994).

Rich and Hart(15) described a family in which a low-oxygen affinity [beta]-chain variant hemoglobin, Hb Warsaw, and pulmonary hypertension appear to cosegregate. The propositus and two sons carried the abnormal hemoglobin. The index case and one son also had raised pulmonary pressures suggestive of pulmonary hypertension. His sibling with known Hb Warsaw had normal exercise testing but an abnormal ventilation-perfusion scan and increased fibrinopeptide A levels. It was proposed that the gene for familial PPH may be located near the [beta]-globin gene on chromosome 11.

This report adds further evidence to the possibility that a gene which causes or induces a susceptibility to primary pulmonary hypertension may be near the [beta]-globin locus. The [beta]-globin gene has been well studied, and several sites of DNA polymorphism have been described.(16) We plan to initiate linkage analysis studies when additional families with PPH are identified. By this approach, we will establish whether familial PPH is due to a gene on chromosome 11. Identification of a gene causing familial PPH will provide insights into the mechanisms of pulmonary hypertension and perhaps lead to the development of novel therapeutic approaches.

ACKNOWLEDGMENTS: We would like to thank Pam Lewis, nurse coordinator in the dyspnea clinic in the Division of Pulmonary Medicine, University of Michigan, for arranging all the family studies. We also thank Drs. Melvyn Rubenfire and William Fay for critical review of the manuscript and Dr. David Ginsburg for thoughtful discussions.

REFERENCES

(1) Loyd J, Primm R, Newman J. Familial primary pulmonary hypertension: clinical patterns. Am Rev Respir Disease 1992; 145:793-97

(2) Wagenvoort C, Wagenvoort N. Primary pulmonary hypertension. Circulation 1970; 42:1163-72

(3) Krishnan K, Martinez F, Cooney K, et al. Co-inheritance of a low oxygen affinity hemoglobin, Hb Washtenaw, beta [11(A8) Val[right arrow]phe] and primary pulmonary hypertension in a Hungarian-American kindred [abstract]. Blood 1993; 82:471a

(4) Krishnan K, Martinez F, Wille RT, et al. Hb Washtenaw [[[[alpha].sub.2][beta].sub.2]11(A8) val[right arrow]phe]: a new electrophoretically, silent low oxygen affinity variant hemoglobin associated with chronic cyanosis. Hemoglobin 1994; 18:285-95

(5) Orkin SH, Kazazian HH Jr, Antonarakis SE, et al. Linkage of [beta]-thalassaemia mutations and [beta]-globin gene polymorphisms with DNA polymorphisms in human [beta]-globin gene cluster. Nature 1982; 296:627-31

(6) Himelman RB, Stulberg M, Kircher B, et al. Noninvasive evaluation of pulmonary artery pressure during exercise by saline-enhanced Doppler echocardiography in chronic pulmonary disease. Circulation 1989; 79:863-71

(7) Feigenbaum H. Hemodynamic information derived from echocardiography. In: Feigenbaum H, ed. Echocardiography. 5th ed. Philadelphia: Lea & Febiger, 1994; 195-98

(8) Carpenter NJ. Genetic anticipation: expanding tandem repeats. Neurol Clin 1994; 12:683-97

(9) Loyd JE, Butler MG, Foroud TM, et al. Genetic anticipation and abnormal gender ratio at birth in familial primary pulmonary hypertension. Am J Respir Crit Care Med 1995;152:93-97

(10) Eisenberg PR, Lucore C, Kaufman L, et al. Fibrinopeptide A levels indicative of pulmonary vascular thrombosis in patients with primary pulmonary hypertension. Circulation 1990; 82:841-47

(11) Morse J, Barst R, Fotino M. Familial pulmonary hypertension: immunogenetic findings in four Caucasian kindreds. Am Rev Respir Dis 1992; 145:787-92

(12) Sato K, Webb S, Tucker A, et al. Factors influencing the idiopathic development of pulmonary hypertension in the fawn hooded rat. Am Rev Respir Dis 1992; 145:793-97

(13) Collins FS, Orringer E. Pulmonary hypertension and cor pulmonale in the sickle hemoglobinopathies. Am J Med 1982; 73:814-21

(14) Berglund S, Linell F. Fibrosis and carcinoma of the lung in a family with haemoglobin Malmo. Scand J Haematol 1972; 9:424-32

(15) Rich S, Hart K. Familial pulmonary hypertension in association with an abnormal hemoglobin. Chest 1991; 99:1208-10

(16) Bunn HF, Forget BG. Hemoglobin: molecular, genetic and clinical aspects. Philadelphia: WB Saunders, 1986

COPYRIGHT 1996 American College of Chest Physicians
COPYRIGHT 2004 Gale Group